Étude d’un exemple : l’expédition tara

A la fin de la séance je sais :

  • exploiter des données obtenues au cours d’explorations scientifiques pour estimer la biodiversité
  • que la biodiversité se mesure par des techniques d’échantillonnage (spécimens ou ADN)

A partir des documents proposés, expliquer comment les expéditions Tara pratiquant les méthodes d’échantillonnages ainsi que le séquençage d’ADNe permettent d’évaluer la biodiversité d’un milieu marin.

Entre 2009 et 2013, la goélette Tara a permis aux scientifiques d’étudier la biodiversité peu connue du plancton océanique. Ces microorganismes sont indispensables à l’équilibre des écosystèmes marins. Par exemple le plancton végétal (phytoplancton), grâce à la photosynthèse est à la base des chaînes alimentaires et jouent un rôle majeur dans la régulation du climat en absorbant de grandes quantités de CO2.

Pendant 4 ans, le navire a sillonné l’ensemble des mers et des océans du globe explorant 154 stations de prélèvements et récoltant 27 000 échantillons traités par 23 laboratoires partenaires. Ainsi, les centaines de scientifiques sont impliqués dans le traitement des données, permettant de faire des découvertes majeures dans la compréhension du plancton.

Actuellement la goélette est encore en activité et mène d’autres expéditions scientifiques (étude du corail, des plastiques océaniques…).

Étape  1 : collecter les données

A l҃’aide de l҃’interview de Julie Poulain , rédiger un petit texte sur la façon dont ont été collectés les échantillons destinés à la génomique lors de TARA OCEANS.

Document 1 : Des outils d’échantillonnage variés

Les filets permettent d’attraper les organismes plus gros que la taille de la maille (de 5 à 190 µm). Ils sont immergés à différentes profondeurs depuis la surface jusqu’à 1000 m et doivent être soigneusement nettoyés après chaque utilisation.

La pompe péristaltique pompe l’eau entre 10 et 120 m de profondeur, celle-ci est ensuite filtrée dans des tamis et des filtres de plus en plus petits pour séparer les organismes par ordre de taille. Photo N. PANSIOT/TARA EXPÉDITIONS

La rosette CTD (Conductivity, Temperature, Depth) est un ensemble de 10 bouteilles qui s’ouvrent à des profondeurs différentes pour collecter l’eau jusqu’à 2000 m. Des capteurs associés permettent de mesurer la conductivité, la température, la pression, la salinité, l’oxygène dissous…

Comment attrape-t-on le plancton ?

Qu’est ce qu’une station de prélèvement ?

ANALYSE LES MAILLES DES FILETS

Catégories

Bactéries

Pico-eucaryotes

Nanoplancton

Microplancton

Mesozooplancton

Macroplancton

Taille (µm)

0,2 – 0,6

1-2

3-25

25-300

100-1000

>1000

1./ Que signifie l’unité de longueur utilisée « µm » ?

2./ Les diatomées et copépodes sont des organismes phyto- et zoo-planctoniques très répandus. Ils mesurent en moyenne respectivement 100 µm et 1 mm. Dans quelle catégorie de taille les ranges-tu selon le tableau fourni ?

3./ A bord de Tara, tu disposes de 7 filets différents qui ont des tailles de maille allant de 5 à 690 µm. Le(s)quel(s) de ces filets permet de récolter des bactéries ? Du nanoplancton ? Du macroplancton ?

Filet bongo (double collecteur) : mailles de 180 µm et de 300 µm

Filet WPII-A : maille de 50 µm

Filet WPII-B : maille de 200 µm

Filet régent : maille de 680 µm

Double 20 : maille de 20 µm

Le 5 : maille de 5 µm

Multinet : maille de 500 µm

4./ Quels autres types d’organismes le filet qui permet de collecter les bactéries va-t-il collecter aussi ? Comment t’y prendrais-tu pour ne récolter que des bactéries ?

5./ Le tripode est constitué de tamis superposés de mailles différentes. Pour qu’il fonctionne correctement, quel type de tamis faut-il mettre en premier sur le chemin de l’eau de mer ? Celui qui a la maille la plus grande ou celui qui a la maille la plus petite?

6./ Remets les tamis dans le bon ordre pour que le tripode fonctionne correctement.

7./ Explique l’avantage du tripode par rapport à un filet à plancton classique.

Étape  2 : traiter et analyser les données

Pendant plus de 3 ans, l’expédition Tara Oceans a récolté 35000 échantillons d’organismes planctoniques. La plupart d’entre eux ont été analysé grâce aux techniques méta-génomiques. Plus d’1 milliard de séquences d’ADN ont ainsi été collectées ! Nous vous proposons de travailler avec quelques séquences choisies qui rendront concrètes l’utilisation de l’ADN par les scientifiques. Vous pourrez introduire les séquences dans les comparateurs de base de données et en déduire le type de plancton. Le plancton ramené dans les filets est observé et identifié. Le nombre d’individus d’une population peut alors être estimé. Au milieu des organismes reconnus, de nouvelles espèces sont sans cesse découvertes.

Les ADN présents dans un environnement (eau de mer par exemple) proviennent de nombreuses espèces. Leur séquençage, qui consiste à déterminer l’ordre des nucléotides (A, T, G, C) de l’ADN permet d’identifier les espèces et d’estimer leur abondance.

La biodiversité est donc estimée par deux paramètres :

  • L’abondance, c’est-à-dire le nombre d’individus
  • La richesse spécifique, c’est-à-dire le nombre d’espèces présentes

Tous les organismes vivants laissent dans leur milieu des cellules (cellules de la peau, des gamètes, …). L’ADN environnemental (ADNe) est un mélange d’ADN intracellulaire provenant de cellules vivantes et d’ADN extracellulaire issu de cellules dégradées. Dans le milieu aquatique, l’ADNe se dégrade en quelques jours : il témoigne de la présence actuelle ou très récente d’une espèce dans le milieu échantillonné. Cette technique permet de détecter la présence d’espèces rares ou difficiles à observer.

 Identifier des espèces planctonique à partir de l’ADNe récolté en utilisant le comparateur de données BLAST (Données_ADN_Tara_Stations_20_41_66_109)

Blast est un logiciel qui permet de comparer une séquence d’ADN déterminée à une banque mondiale de données et d’identifier une éventuelle espèce associée. Ainsi on peut comparer une séquence d’intérêt (inconnue) à une banque de données constituée de milliards de séquences référencées et dont l’espèce d’origine est connue. On peut également déterminer l’identité de cette séquence (« de quelle séquence ma séquence est la plus proche ») : à quelle espèce elle appartient, et quelle est la fonction de cette séquence.

 Fiche_Technique_Blast

Le logiciel est accessible à partir de l’adresse suivante : https://blast.ncbi.nlm.nih.gov/Blast.cgi ; sur le site :

  • Cliquer sur « Nucleotide Blast ».
  • Rentrer la séquence à comparer (ex avec espèce 1) : «gtcgcacctaccgattgaatggtccggtgaggactcgggattgtggtttggctccttcattggggcctgactgcgagaacttgtccgaaccttatcatttagaggaaggtgaagtcgtaacaaggtttcc».
  • Dans l’onglet « Choose Search Set », vérifier que « Standard databases (nr etc.): » soit bien sélectionné.
  • Dans l’onglet « Program Selection », sélectionner le programme : « Somewhat similar sequences (blastn)».
  • Dans l’onglet « Algorithm parameters » (dessous le bouton Blast), indiquer 5 dans « Max matches in a query range » pour afficher seulement les 5 meilleures correspondances à la séquence inconnue.
  • Lancer le  Blast

    Les résultats sont les noms des séquences trouvées dans la base de données qui ressemblent à votre séquence inconnue. Les résultats sont classés par du plus grand au plus petit pourcentage d’identité entre vos séquences inconnues et les séquences ressemblantes. Si on a 100% d’identité, on peut confirmer l’identité de la séquence inconnue. En dessous de 85%, on ne peut rien dire. Un résultat affichant « Uncultured » indique que la séquence alignée n’est pas identifiée.

    Lien vers les photos des espèces de plancton trouvés

Retour vers la page sur  le recensement de la biodiversité d’un écosystème


Pour aller plus loin

 

  • Des fleuves de plastique

La goélette Tara vient de boucler son périple de six mois sur les plus grands fleuves d’Europe. Cette aventure scientifique va permettre de mieux comprendre l’origine de la pollution plastique qui frappe les océans. Chaque année, 8 millions de tonnes de déchets plastiques sont déversées dans les mers.

Lien vers photos mission Tara

 

%d blogueurs aiment cette page :